98 lines
5.5 KiB
Plaintext
98 lines
5.5 KiB
Plaintext
[--------------------------------------------------------------------------]
|
|
ooooo ooooo .oooooo. oooooooooooo HOE E'ZINE RELEASE #580
|
|
`888' `888' d8P' `Y8b `888' `8
|
|
888 888 888 888 888 "DNA, The Perfect Template
|
|
888ooooo888 888 888 888oooo8 for a Metaphor"
|
|
888 888 888 888 888 "
|
|
888 888 `88b d88' 888 o by Anilos [4/14/99]
|
|
o888o o888o `Y8bood8P' o888ooooood8
|
|
[--------------------------------------------------------------------------]
|
|
|
|
Over my spring break I learned a lot of different things, but more
|
|
important of all is the epiphany I had one night in the vector of
|
|
inspiration for me, the garage. I'm fairly certain now that Molecular
|
|
Biology can be a metaphor for just about anything in life, allow me to
|
|
elucdicate... DNA, the little molecule that is the blueprints for our
|
|
entire body is essentially a message, a story, if you will. Before I
|
|
continue I just would like to apologize to the people reading this and not
|
|
understanding a damn thing, I just feel I should write about this since I
|
|
find it fascinating. There is a lot about DNA that would take up pages and
|
|
pages of explanation, but I'm trying to appeal to all people here so I'll
|
|
try to make it short and simple.
|
|
|
|
DNA is two nucleotides wound together in the double helix I'm sure
|
|
everyone has heard at least once (i.e. Those who have seen Jurassic park,
|
|
more than likely). The "rungs" on the DNA "Ladder" are essentially
|
|
nitrogen bases We won't refer to them by their technical names and instead
|
|
as A,T,G, and C. Now then, In DNA the A's must pair with a T and the G's
|
|
must pair with a C and vice versa (T to A and C to G). If your still with
|
|
me, pat yourself on the back, I don't plan on putting in any references to
|
|
sex, gatorade or rage (which is going to be really hard for me). So, if
|
|
your looking for any of the aforementioned, just stop. I'm sitting in my
|
|
garage now and I was thinking about the days lesson in Molecular biology...
|
|
Mutations. I began to think, "Hmm, now, mutations can be beneficial or
|
|
harmful. And DNA itself is a message which might very well decide
|
|
important aspects of our lives, therefore we can use DNA as a metaphor for
|
|
life! Yes! This will probably bore some people, but goddamnit, I don't
|
|
care."
|
|
|
|
Let's write out a basic DNA 'Message':
|
|
|
|
(I'm going to use an acquaintence's name as an example, and because
|
|
it's already written down on paper and I don't want to use mine, it would
|
|
take too long.)
|
|
|
|
ACATTGTTTTTTGATCGGTTCTGGTTATTCTAGTAGGATCGCCCGTTTTTGCCACCA
|
|
|
|
- Now, believe it or not, this in fact actually spells out my
|
|
acquaintence's name "Matt Eric Biggerstaff" (The translation of
|
|
the message isn't important nor relevant to the point of this, but
|
|
hell, if your interested anyways just e-mail me). Basically, this
|
|
is a normal, happy little piece of DNA. Mutations, though can
|
|
screw the message up, so we can assume, that if life was a DNA
|
|
strand, mutations could screw up someone's life. Let us look at
|
|
some common mutations and practical applications to this
|
|
metaphorical look at DNA:
|
|
|
|
- Substitution: This is where one of the four letters (A,T,C, and
|
|
G) are mispaired (ie. A to G or T to C).
|
|
|
|
An example for life: Instead of your real dad, your mom
|
|
re-marries and substitutes a step-dad, potentiality for a screw
|
|
up/misreading of the DNA.
|
|
|
|
- Insertion: DNA is read in tripletts (GAT, TTT, etc.) but with
|
|
insertion you end up with sequences such as, GATA, TTT, etc.
|
|
|
|
Another example for life: I began to date a very odd girl that
|
|
only made my life miserable, essentially she was "inserted" into
|
|
my life (I know some of you are giggling at the word 'insert').
|
|
|
|
- Deletion: When being read in tripletts, this is when a A,C,G or
|
|
T is missing (i.e. the small message above, GAT, TTT may become
|
|
GA, TTT).
|
|
|
|
My example for life using someone I'm sure everyone has heard me
|
|
bitch about: I dated this really nice girl, the most wonderful
|
|
and best thing I've ever had in my fairly lonely and boring life.
|
|
But I broke up with her because of reasons I even don't know, she
|
|
was "deleted" from my life and of course everything went screwy.
|
|
|
|
Many of you are probably thinking now, "But, mistakes can't screw up
|
|
someone's entire life, your wrong in your comparison of DNA mutations to
|
|
everyday life". True, you are very sharp indeed if you thought that. But
|
|
alas, I'm not finished quite yet. Sure, one mistake obviously isn't going
|
|
to screw over your entire life like a mutation can do in a human's DNA.
|
|
But, there is a repair 'tool' you might say that exists in DNA. This
|
|
veritable repair utility finds mutations and fixes them before they can
|
|
cause any significant damage. I'm right, and your wrong. Whee, I love
|
|
being in control somewhat. I hope this made at least a small amount of
|
|
sense, if it didn't just tell me. I'll more than likely ignore you, but
|
|
hey at least you tried! Or you can always deflate my ego by sending me a
|
|
message pointing out mistakes. Either way, I'll write something more
|
|
appealing to the masses next time, but for now I'm on spring break -- thank
|
|
God -- and I feel like indulging in what I want.
|
|
|
|
[--------------------------------------------------------------------------]
|
|
[ (c) !LA HOE REVOLUCION PRESS! HOE #580 - WRITTEN BY: ANILOS - 4/14/99 ]
|